SlideShare a Scribd company logo

Session 5.3 Levy

•
•
Albert Einstein Cancer Center
Albert Einstein Cancer Center

Matthew Levy

Health & MedicineTechnologyBusiness
1 of 20
Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
Aptamers ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Aptamers exist naturally ,[object Object]
In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
Aptamers that target cell surface receptors can be used for delivery of cargoes to cells ,[object Object],[object Object],[object Object],Hicke et al. J Nucl Med. 2006 Apr;47(4):668-78 Anti-PSMA aptamer Anti-hTfR aptamer Anti-Tenascin C aptamer Aptamers can be used to target in vivo
Cancer/Aptamer projects underway in my lab ,[object Object],[object Object],[object Object],[object Object],[object Object]
The transferrin receptor (TfR, CD71) ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Selection for aptamers targeting the transferrin receptor ,[object Object],[object Object]
Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
Prostate-specific membrane antigen ,[object Object],[object Object],[object Object],[object Object],[object Object],Using a library based on the A9 aptamer we have now performed a ‘doped’ selection Cytoplasmic domain Transmembrane domain Extracellular domain NH 2 COOH Catalytic domain NH 2 COOH Catalytic domain
Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
[object Object]
Targeting DEC 205 ,[object Object],[object Object],[object Object],[object Object]
Targeting cell surface receptors with aptamers anti-DEC205 ,[object Object],[object Object]
[object Object],Brian Wengerter Anti-DEC205 aptamers bind CHO cells that express DEC205
[object Object],[object Object],Brian Wengerter
Summary ,[object Object],[object Object],[object Object],[object Object]
Acknowledgements ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]

Recommended

Estudiantes
EstudiantesEstudiantes
EstudiantesJhonLara14
 
Sequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMSequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMThermo Fisher Scientific
 
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...QIAGEN
 
Defining the relevant genome in solid tumors
Defining the relevant genome in solid tumorsDefining the relevant genome in solid tumors
Defining the relevant genome in solid tumorsThermo Fisher Scientific
 
Next-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicNext-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicQIAGEN
 
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]Barun Kumar Sahu
 
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMSequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
 
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...QIAGEN
 

Recommended

Estudiantes
EstudiantesEstudiantes
EstudiantesJhonLara14
 
Sequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMSequencing the Human TCRβ Repertoire on the Ion S5TM
Sequencing the Human TCRβ Repertoire on the Ion S5TMThermo Fisher Scientific
 
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...
Enabling CNV Studies from Single Cells Using Whole Genome Amplification and L...QIAGEN
 
Defining the relevant genome in solid tumors
Defining the relevant genome in solid tumorsDefining the relevant genome in solid tumors
Defining the relevant genome in solid tumorsThermo Fisher Scientific
 
Next-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicNext-Generation Sequencing Clinical Research Milestones Infographic
Next-Generation Sequencing Clinical Research Milestones InfographicQIAGEN
 
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]
CRISPR Based Diagnosis For SARS-CoV-2[FELUDA]Barun Kumar Sahu
 
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMSequencing the circulating and infiltrating T-cell repertoire on the Ion S5TM
Sequencing the circulating and infiltrating T-cell repertoire on the Ion S5TMThermo Fisher Scientific
 
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...
Developing a Rapid Clinical Sequencing System to Classify Meningioma: Meet th...QIAGEN
 
Applications of Single Cell Analysis
Applications of Single Cell AnalysisApplications of Single Cell Analysis
Applications of Single Cell AnalysisQIAGEN
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...QIAGEN
 
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter regionTaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter regionThermo Fisher Scientific
 
CRISPR /Cas9
CRISPR /Cas9CRISPR /Cas9
CRISPR /Cas9RatherIrfan
 
Clinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidanceClinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidanceNikesh Shah
 
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Dr. Priyabrata Pattnaik
 
The Clinical Genome Conference 2014
The Clinical Genome Conference 2014The Clinical Genome Conference 2014
The Clinical Genome Conference 2014Nicole Proulx
 
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
 
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationDr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationJohn Blue
 
mRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative BiolabsmRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative BiolabsCreative-Biolabs
 
Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering Creative-Biolabs
 
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...QIAGEN
 
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...ponenciasexpoquim11
 
Lepow Day Poster 2
Lepow Day Poster 2Lepow Day Poster 2
Lepow Day Poster 2David Dornblaser
 
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2QIAGEN
 
Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9 Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9 Ek Han Tan
 
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAAn NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAThermo Fisher Scientific
 
miScript Single Cell Poster
miScript Single Cell PostermiScript Single Cell Poster
miScript Single Cell PosterQIAGEN
 
Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9 Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9 XinLu52
 
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine ResearchDeveloping Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine ResearchKate Barlow
 
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISHtcha163
 

More Related Content

What's hot

Applications of Single Cell Analysis
Applications of Single Cell AnalysisApplications of Single Cell Analysis
Applications of Single Cell AnalysisQIAGEN
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...QIAGEN
 
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter regionTaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter regionThermo Fisher Scientific
 
Clinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidanceClinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidanceNikesh Shah
 
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Dr. Priyabrata Pattnaik
 
The Clinical Genome Conference 2014
The Clinical Genome Conference 2014The Clinical Genome Conference 2014
The Clinical Genome Conference 2014Nicole Proulx
 
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Thermo Fisher Scientific
 
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationDr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationJohn Blue
 
mRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative BiolabsmRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative BiolabsCreative-Biolabs
 
Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering Creative-Biolabs
 
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...QIAGEN
 
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...ponenciasexpoquim11
 
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2QIAGEN
 
Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9 Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9 Ek Han Tan
 
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAAn NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAThermo Fisher Scientific
 
miScript Single Cell Poster
miScript Single Cell PostermiScript Single Cell Poster
miScript Single Cell PosterQIAGEN
 
Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9 Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9 XinLu52
 
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine ResearchDeveloping Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine ResearchKate Barlow
 

What's hot (20)

Applications of Single Cell Analysis
Applications of Single Cell AnalysisApplications of Single Cell Analysis
Applications of Single Cell Analysis
 
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
Targeted Single Cell Sequencing for Accurate Mutation Detection in Heterogene...
 
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter regionTaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
TaqMan dPCR Liquid Biopsy Assays targeting the TERT promoter region
 
CRISPR /Cas9
CRISPR /Cas9CRISPR /Cas9
CRISPR /Cas9
 
Clinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidanceClinical molecular diagnostics for drug guidance
Clinical molecular diagnostics for drug guidance
 
Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...Production and purification of Viral vectors for gene and cell therapy appli...
Production and purification of Viral vectors for gene and cell therapy appli...
 
The Clinical Genome Conference 2014
The Clinical Genome Conference 2014The Clinical Genome Conference 2014
The Clinical Genome Conference 2014
 
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
Gene expression profile of the tumor microenvironment from 40 NSCLC FFPE and ...
 
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and CharacterizationDr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
Dr. Ben Hause - Metagenomic Sequencing for Virus Discovery and Characterization
 
mRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative BiolabsmRNA-based Therapeutics - Creative Biolabs
mRNA-based Therapeutics - Creative Biolabs
 
Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering Viral Based Gene Delivery System for Car-t Cell Engineering
Viral Based Gene Delivery System for Car-t Cell Engineering
 
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
Detection and Surveillance of Antibiotic Resistance Genes From Food and Ferti...
 
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
Víctor M. González - Introducción a la tecnología de aptámeros y posibles apl...
 
Lepow Day Poster 2
Lepow Day Poster 2Lepow Day Poster 2
Lepow Day Poster 2
 
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
Translational Genomics and Prostate Cancer: Meet the NGS Experts Series Part 2
 
Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9 Genome Editing CRISPR-Cas9
Genome Editing CRISPR-Cas9
 
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNAAn NGS workflow to detect down to 0.1% allelic frequency in cfDNA
An NGS workflow to detect down to 0.1% allelic frequency in cfDNA
 
miScript Single Cell Poster
miScript Single Cell PostermiScript Single Cell Poster
miScript Single Cell Poster
 
Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9 Lentiviral mediated CRISPR/Cas9
Lentiviral mediated CRISPR/Cas9
 
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine ResearchDeveloping Ultra-Sensitive PCR Protocols for HIV Vaccine Research
Developing Ultra-Sensitive PCR Protocols for HIV Vaccine Research
 

Similar to Session 5.3 Levy

An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...Thermo Fisher Scientific
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISHtcha163
 
Avs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAvs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAMOL SHITOLE
 
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Thermo Fisher Scientific
 
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsChimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsCreative-Biolabs
 
Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Elsa von Licy
 
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrDiscover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrJessica Myers
 
NEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxNEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxmadurai
 
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Thermo Fisher Scientific
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3Michael Powell
 
Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Beth Salazar
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptxArdiansyahPrayitno2
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Thermo Fisher Scientific
 
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Thermo Fisher Scientific
 

Similar to Session 5.3 Levy (20)

An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
An Efficient NGS Workflow for Liquid Biopsy Research Using a Comprehensive As...
 
PCR, RT-PCR, FISH
PCR, RT-PCR, FISHPCR, RT-PCR, FISH
PCR, RT-PCR, FISH
 
Avs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogensAvs molecular diagnostic techniques for detection of plant pathogens
Avs molecular diagnostic techniques for detection of plant pathogens
 
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
Development of a Breast and Lung Cancer Research Panel To Target Therapeutica...
 
targeting
targetingtargeting
targeting
 
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative BiolabsChimeric Antigen Receptor (car) Technique-Creative Biolabs
Chimeric Antigen Receptor (car) Technique-Creative Biolabs
 
Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013Epi tect methylation qpcr arrays 2013
Epi tect methylation qpcr arrays 2013
 
IJAA
IJAAIJAA
IJAA
 
Discover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And EgfrDiscover Therapeutic Aptamers For Vegf165 And Egfr
Discover Therapeutic Aptamers For Vegf165 And Egfr
 
NEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptxNEW AGE ADC IN LUNG CANCER 2022.pptx
NEW AGE ADC IN LUNG CANCER 2022.pptx
 
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
Circulating Cell Free DNA Targeted Sequencing Workflow | ESHG 2015 Poster PM1...
 
High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3High Sensitivity Detection of Tumor Gene Mutations-v3
High Sensitivity Detection of Tumor Gene Mutations-v3
 
3targeting
3targeting3targeting
3targeting
 
Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287Western Blotting Of Camkii Β And T 287
Western Blotting Of Camkii Β And T 287
 
ICAAC 2013: Resumen
ICAAC 2013: ResumenICAAC 2013: Resumen
ICAAC 2013: Resumen
 
6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx6. Molek tech.pptx [Repaired].pptx
6. Molek tech.pptx [Repaired].pptx
 
Aptamers
AptamersAptamers
Aptamers
 
EACR-P0ster-17
EACR-P0ster-17EACR-P0ster-17
EACR-P0ster-17
 
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
Clinical Validation of an NGS-based (CE-IVD) Kit for Targeted Detection of Ge...
 
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...Computational Methods for detection of somatic mutations at 0.1% frequency fr...
Computational Methods for detection of somatic mutations at 0.1% frequency fr...
 

More from Albert Einstein Cancer Center

More from Albert Einstein Cancer Center (20)

Advances Agenda Slide 2016
Advances Agenda Slide 2016Advances Agenda Slide 2016
Advances Agenda Slide 2016
 
Nciccwithsocialmedia
NciccwithsocialmediaNciccwithsocialmedia
Nciccwithsocialmedia
 
000 agenda
000 agenda000 agenda
000 agenda
 
The Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paperThe Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paper
 
Using MyNCBI & My Bibliography
Using MyNCBI & My BibliographyUsing MyNCBI & My Bibliography
Using MyNCBI & My Bibliography
 
Using MyNCBI & My Bibliography
Using MyNCBI & My BibliographyUsing MyNCBI & My Bibliography
Using MyNCBI & My Bibliography
 
The Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paperThe Biosketch format, SciENcv and the paper
The Biosketch format, SciENcv and the paper
 
Using My NCBI & My Bibliography
Using My NCBI & My BibliographyUsing My NCBI & My Bibliography
Using My NCBI & My Bibliography
 
Nih public access_policy
Nih public access_policyNih public access_policy
Nih public access_policy
 
Guide for My Bibliography and Compliance
Guide for My Bibliography and ComplianceGuide for My Bibliography and Compliance
Guide for My Bibliography and Compliance
 
Nciccwithsocialmedia
NciccwithsocialmediaNciccwithsocialmedia
Nciccwithsocialmedia
 
NCICC with socialmedia
NCICC with socialmediaNCICC with socialmedia
NCICC with socialmedia
 
04.2 kurland pc
04.2 kurland pc04.2 kurland pc
04.2 kurland pc
 
03.1 libutti pc
03.1 libutti pc03.1 libutti pc
03.1 libutti pc
 
02.3 gabeau mac
02.3 gabeau mac02.3 gabeau mac
02.3 gabeau mac
 
02.2 kaubisch pc
02.2 kaubisch pc02.2 kaubisch pc
02.2 kaubisch pc
 
02.1 kinkhabwala
02.1 kinkhabwala02.1 kinkhabwala
02.1 kinkhabwala
 
01.5 belbin aecc advances 2010 for web
01.5 belbin aecc advances 2010 for web01.5 belbin aecc advances 2010 for web
01.5 belbin aecc advances 2010 for web
 
01.4 steidl pc for upload
01.4 steidl pc for upload01.4 steidl pc for upload
01.4 steidl pc for upload
 
01.3 klampfer pc
01.3 klampfer pc01.3 klampfer pc
01.3 klampfer pc
 

Recently uploaded

Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeCall Girls Delhi
 
Call Girls Bareilly Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...astropune
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋TANUJA PANDEY
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...narwatsonia7
 
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...parulsinha
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...Taniya Sharma
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426jennyeacort
 
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Ishani Gupta
 
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Dipal Arora
 
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...chandars293
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...parulsinha
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...jageshsingh5554
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableDipal Arora
 
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...parulsinha
 
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableDipal Arora
 
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...perfect solution
 

Recently uploaded (20)

Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any TimeTop Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
Top Quality Call Girl Service Kalyanpur 6378878445 Available Call Girls Any Time
 
Call Girls Bareilly Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Bareilly Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Bareilly Just Call 8250077686 Top Class Call Girl Service Available
 
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
♛VVIP Hyderabad Call Girls Chintalkunta🖕7001035870🖕Riya Kappor Top Call Girl ...
 
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
VIP Hyderabad Call Girls Bahadurpally 7877925207 ₹5000 To 25K With AC Room 💚😋
 
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
Top Rated Bangalore Call Girls Ramamurthy Nagar ⟟ 9332606886 ⟟ Call Me For G...
 
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Ooty Just Call 8250077686 Top Class Call Girl Service Available
 
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
Russian Call Girls Service Jaipur {8445551418} ❤️PALLAVI VIP Jaipur Call Gir...
 
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
(👑VVIP ISHAAN ) Russian Call Girls Service Navi Mumbai🖕9920874524🖕Independent...
 
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
Call Girls in Delhi Triveni Complex Escort Service(🔝))/WhatsApp 97111⇛47426
 
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
Mumbai ] (Call Girls) in Mumbai 10k @ I'm VIP Independent Escorts Girls 98333...
 
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
Best Rate (Patna ) Call Girls Patna ⟟ 8617370543 ⟟ High Class Call Girl In 5 ...
 
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Dehradun Just Call 9907093804 Top Class Call Girl Service Available
 
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
The Most Attractive Hyderabad Call Girls Kothapet 𖠋 9332606886 𖠋 Will You Mis...
 
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
(Low Rate RASHMI ) Rate Of Call Girls Jaipur ❣ 8445551418 ❣ Elite Models & Ce...
 
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
VIP Service Call Girls Sindhi Colony 📳 7877925207 For 18+ VIP Call Girl At Th...
 
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service AvailableCall Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
Call Girls Coimbatore Just Call 9907093804 Top Class Call Girl Service Available
 
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
Premium Call Girls In Jaipur {8445551418} ❤️VVIP SEEMA Call Girl in Jaipur Ra...
 
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service AvailableCall Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
Call Girls Gwalior Just Call 8617370543 Top Class Call Girl Service Available
 
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Varanasi Just Call 8250077686 Top Class Call Girl Service Available
 
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
College Call Girls in Haridwar 9667172968 Short 4000 Night 10000 Best call gi...
 

Session 5.3 Levy

  • 1. Levy Lab Matthew Levy Department of Biochemistry Albert Einstein College of Medicine Targeting cells with aptamers
  • 2.
  • 3.
  • 4. In vitro selection of aptamers Constant regions Random region Of 40 nucleotides Library size = ~10 14-15
  • 5.
  • 6.
  • 7.
  • 8.
  • 9. Anti-TfR aptamers label multiple human cancer cell lines FACs based analysis using AF488 labeled aptamer
  • 10. Minimization eliminates more than half of the c2 sequence. c2 c2.min.2 c2.min.6 c2.min.9.1 38.6 kDa 14.0 kDa Brian Wengerter
  • 11.
  • 12. Doped A9 selection GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly Heavily mutagenize (30%) Reselect (HeLa-PSMA cells)
  • 13. Minimization of the anti-PSMA A9 aptamer GGGAGGACGATGCGGACCGAAAAAGACCTGACTTCTATACTAAGTCTACGTTCCCAGACGACTCGCCC (68) Linsley Kelly
  • 14.
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.

Editor's Notes

  1. 20070212 combination of all data
  2. 20070212 combination of all data